About   Help   FAQ
Opn3em1Eoan
Endonuclease-mediated Allele Detail
Summary
Symbol: Opn3em1Eoan
Name: opsin 3; endonuclease-mediated mutation 1, Elena Oancea
MGI ID: MGI:7312065
Synonyms: OPN3-mCherry
Gene: Opn3  Location: Chr1:175489993-175520198 bp, - strand  Genetic Position: Chr1, 81.66 cM, cytoband H3
Alliance: Opn3em1Eoan page
Mutation
origin
Strain of Origin:  C57BL/6
Mutation
description
Allele Type:    Endonuclease-mediated (Reporter)
Mutation:    Insertion
 
Mutation detailsCRISPR/Cas9 endonuclease-mediated homology-directed repair (HDR) genome editing is used to insert an mCherry reporter in-frame before the termination codon. A combination of two sgRNAs (sgRNA1 ATTCTTATAGAGGACGCACT and sgRNA2 AAGTGCGTCCTCTATAAGAA or sgRNA1 and sgRNA3 AACATTGTGGTGGCTGATAT) is used to traget the junction between exon 4 and the 3' untranslated region (UTR). (J:302430)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Opn3 Mutation:  25 strains or lines available
References
Original:  J:302430 Olinski LE, et al., Endogenous Opsin 3 (OPN3) Protein Expression in the Adult Brain Using a Novel OPN3-mCherry Knock-In Mouse Model. eNeuro. 2020 Sep/Oct;7(5):ENEURO.0107-20.2020
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory