Opn3^em1Eoan
Endonuclease-mediated Allele Detail

Summary

• Symbol: Opn3^em1Eoan
• Name: opsin 3; endonuclease-mediated mutation 1, Elena Oancea
• MGI ID: MGI:7312065
• Synonyms: OPN3-mCherry
• Gene: Opn3 Location: Chr1:175489993-175520198 bp, - strand Genetic Position: Chr1, 81.66 cM, cytoband H3
• Alliance: Opn3^em1Eoan page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Reporter)
• Mutation: Insertion
• Mutation details: CRISPR/Cas9 endonuclease-mediated homology-directed repair (HDR) genome editing is used to insert an mCherry reporter in-frame before the termination codon. A combination of two sgRNAs (sgRNA1 ATTCTTATAGAGGACGCACT and sgRNA2 AAGTGCGTCCTCTATAAGAA or sgRNA1 and sgRNA3 AACATTGTGGTGGCTGATAT) is used to traget the junction between exon 4 and the 3' untranslated region (UTR). (J:302430)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Opn3 Mutation: 24 strains or lines available

References

• Original: J:302430 Olinski LE, et al., Endogenous Opsin 3 (OPN3) Protein Expression in the Adult Brain Using a Novel OPN3-mCherry Knock-In Mouse Model. eNeuro. 2020 Sep/Oct;7(5):ENEURO.0107-20.2020
• All: 1 reference(s)