Sec61gem1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Sec61gem1(IMPC)J |
| Name: |
SEC61 translocon subunit gamma; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:7311993 |
| Synonyms: |
Sec61g- |
| Gene: |
Sec61g Location: Chr11:16451638-16458484 bp, - strand Genetic Position: Chr11, 9.41 cM
|
| Alliance: |
Sec61gem1(IMPC)J page
|
| IMPC: |
Sec61g gene page |
|
Sec61gem1(IMPC)J/Sec61gem1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but not at E7.5. Embryos fail to hatch from the zona pellucida and die after 3 days in culture.
Show the 1 phenotype image(s) involving this allele.
|
|
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences, TGACATGGTTCCTATAACAA and GTACATCTAATTCCTCATTG, which resulted in a 4057 bp deletion beginning at Chromosome 11 position 16,454,576 bp and ending after 16,458,632 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001287615, ENSMUSE00001286315, ENSMUSE00000681061 (exons 1,2 and 3) and 3473 bp of intronic sequence including the start site, splice acceptors and donors and is predicted to result in a null allele.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|