Sec61g^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Sec61g^em1(IMPC)J
• Name: SEC61 translocon subunit gamma; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7311993
• Synonyms: Sec61g^-
• Gene: Sec61g Location: Chr11:16451638-16458484 bp, - strand Genetic Position: Chr11, 9.41 cM
• Alliance: Sec61g^em1(IMPC)J page
• IMPC: Sec61g gene page

Sec61g^em1(IMPC)J/Sec61g^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but not at E7.5. Embryos fail to hatch from the zona pellucida and die after 3 days in culture.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences GTACATCTAATTCCTCATTG and TGACATGGTTCCTATAACAA that targeted exon(s) ENSMUSE00000681056.2 ENSMUSE00000681058.2 ENSMUSE00000681061.2 ENSMUSE00001028207.2 ENSMUSE00001274043.2 ENSMUSE00001286315.2 ENSMUSE00001287615.2 ENSMUSE00001288733.2. This resulted in deletion(s) of 4057 bp (location: Chr11:16454576-16458632; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Sec61g Mutation: 15 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)