About   Help   FAQ
Ctu1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ctu1em1(IMPC)J
Name: cytosolic thiouridylase subunit 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7311988
Gene: Ctu1  Location: Chr7:43321440-43327722 bp, + strand  Genetic Position: Chr7, 28.26 cM
Alliance: Ctu1em1(IMPC)J page
IMPC: Ctu1 gene page
Mutation
origin
Strain of Origin:  Not Applicable
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences, GGAGATGGCGTCCTACTGAG and GCAGTCACCCTATTATAGAT, which resulted in a 3606 bp deletion beginning at Chromosome 7 position 43,674,889 bp and ending after 43,678,494 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000279483, ENSMUSE00000401936 (exons 2 and 3) and 1191 bp of intronic sequence including the start site, splice acceptors and donors and is predicted to result in a null allele. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ctu1 Mutation:  28 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory