Ctu1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Ctu1em1(IMPC)J |
Name: |
cytosolic thiouridylase subunit 1; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:7311988 |
Gene: |
Ctu1 Location: Chr7:43321440-43327722 bp, + strand Genetic Position: Chr7, 28.26 cM
|
Alliance: |
Ctu1em1(IMPC)J page
|
IMPC: |
Ctu1 gene page |
|
Strain of Origin: |
Not Applicable
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences, GGAGATGGCGTCCTACTGAG and GCAGTCACCCTATTATAGAT, which resulted in a 3606 bp deletion beginning at Chromosome 7 position 43,674,889 bp and ending after 43,678,494 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000279483, ENSMUSE00000401936 (exons 2 and 3) and 1191 bp of intronic sequence including the start site, splice acceptors and donors and is predicted to result in a null allele.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
1 reference(s) |
|