Ubl3^em1Wehi
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ubl3^em1Wehi
• Name: ubiquitin-like 3; endonuclease-mediated mutation 1, Walter and Eliza Hall Institute of Medical Research
• MGI ID: MGI:7311981
• Gene: Ubl3 Location: Chr5:148441445-148489599 bp, - strand Genetic Position: Chr5, 88.66 cM, cytoband G2-3
• Alliance: Ubl3^em1Wehi page

Mutation origin

• Strain of Origin: Not Specified

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/Cas9 technology using sgRNAs GGCCTCGACCATCCGAGTAA and GCCTGCAAGCAAACCGTTTA targeted exons 2-5 for deletion resulting in a 11.3 kb deletion. (J:324111)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Ubl3 Mutation: 74 strains or lines available

References

• Original: J:324111 Liu H, et al., Ubiquitin-like protein 3 (UBL3) is required for MARCH ubiquitination of major histocompatibility complex class II and CD86. Nat Commun. 2022 Apr 11;13(1):1934
• All: 1 reference(s)