About   Help   FAQ
Rr194em1Mair
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr194em1Mair
Name: regulatory region 194; endonuclease-mediated mutation 1, Pascal Maire
MGI ID: MGI:7285971
Synonyms: SE-
Gene: Rr194  Location: Chr11:66994497-67036366 bp  Genetic Position: Chr11, Syntenic
Alliance: Rr194em1Mair page
Mutation
origin
Strain of Origin:  Not Applicable
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intergenic deletion
 
Mutation detailsThe Myh super enhancer was deleted using sgRNAs (targeting GGGGACTCCTATGTAAGCAA, TCTAGGAGGCCGAGAATGCC, TTGGGAGCAGTCCCATCTGG, CCATGGAAGGACCCCTAATT, CAGACAAGGCCTTCAATTAG and TCTCTGACATCAAGCCATGC) with CRISPR/Cas9 technology. The deletion covers chr11:66994497-67036366 (GRCm39). (J:322002)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr194 Mutation:  0 strains or lines available
References
Original:  J:322002 Dos Santos M, et al., A fast Myosin super enhancer dictates muscle fiber phenotype through competitive interactions with Myosin genes. Nat Commun. 2022 Feb 24;13(1):1039
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/19/2026
MGI 6.24
The Jackson Laboratory