About   Help   FAQ
Rr195em1Mair
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr195em1Mair
Name: regulatory region 195; endonuclease-mediated mutation 1, Pascal Maire
MGI ID: MGI:7285969
Synonyms: EnhA-
Gene: Rr195  Location: Chr11:67029517-67036375 bp  Genetic Position: Chr11, Syntenic
Alliance: Rr195em1Mair page
Mutation
origin
Strain of Origin:  Not Applicable
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intergenic deletion
 
Mutation detailsMyh enhancer A, a sub-region of super enhancer Rr194, was deleted using sgRNAs (targeting GAGAAGAGTCTCGTCATTGTGG, GTCACACTGCCCATCCTCGAGGG, GATGTTCTGCCCTCGAGGATGGG, GATGGAAGGACCCCTAATTAGG, GCAGACAAGGCCTTCAATTAGGGG and GTCTCTGACATCAAGCCATGCAGG) with CRISPR/Cas9 technology. The deletion covers chr11:67029517-67036375 (GRCm39). (J:322002)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr195 Mutation:  0 strains or lines available
References
Original:  J:322002 Dos Santos M, et al., A fast Myosin super enhancer dictates muscle fiber phenotype through competitive interactions with Myosin genes. Nat Commun. 2022 Feb 24;13(1):1039
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory