Npsr1em1Yfu
Endonuclease-mediated Allele Detail
|
Symbol: |
Npsr1em1Yfu |
Name: |
neuropeptide S receptor 1; endonuclease-mediated mutation 1, Ying-Hui Fu |
MGI ID: |
MGI:7284431 |
Synonyms: |
Npsr1m, Npsr1-Y206H |
Gene: |
Npsr1 Location: Chr9:24009292-24227694 bp, + strand Genetic Position: Chr9, 9.99 cM
|
Alliance: |
Npsr1em1Yfu page
|
|
|
Allele Type: |
|
Endonuclease-mediated (Humanized sequence) |
Mutation: |
|
Single point mutation
|
|
|
Mutation details: Using an sgRNA (targeting ) and an ssODN template (GTCCAGCCCGTGGCCTCTCACCTGATAATTGCCAAGGGAATGAAGTACACCAGAAAGGCGACGATGGTCATGTACGGGGTCCAGTGCGAGTCATCCGGCCACAGTGCCCAGCACTGCACCTCACCATTGGAAAGTGTCCTTTTCCCAAATATGATCAGCGTGGGAATGGAGA) with CRISPR/Cas9 technology, tyrosine codon 206 (TAC) was changed to histidine (CAC) (p.Y206H). This mutation is located in a highly conserved extra-cellular domain and the equivalent mutation in humans is associated with familial natural short sleep (FNSS).
(J:325012)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
Carrying any Npsr1 Mutation: |
37 strains or lines available
|
|
Original: |
J:325012 Xing L, et al., Mutant neuropeptide S receptor reduces sleep duration with preserved memory consolidation. Sci Transl Med. 2019 Oct 16;11(514):eaax2014 |
All: |
2 reference(s) |
|