About   Help   FAQ
Npsr1em1Yfu
Endonuclease-mediated Allele Detail
Summary
Symbol: Npsr1em1Yfu
Name: neuropeptide S receptor 1; endonuclease-mediated mutation 1, Ying-Hui Fu
MGI ID: MGI:7284431
Synonyms: Npsr1m, Npsr1-Y206H
Gene: Npsr1  Location: Chr9:24009292-24227694 bp, + strand  Genetic Position: Chr9, 9.99 cM
Alliance: Npsr1em1Yfu page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Single point mutation
 
Mutation details

Using an sgRNA (targeting ) and an ssODN template (GTCCAGCCCGTGGCCTCTCACCTGATAATTGCCAAGGGAATGAAGTACACCAGAAAGGCGACGATGGTCATGTACGGGGTCCAGTGCGAGTCATCCGGCCACAGTGCCCAGCACTGCACCTCACCATTGGAAAGTGTCCTTTTCCCAAATATGATCAGCGTGGGAATGGAGA) with CRISPR/Cas9 technology, tyrosine codon 206 (TAC) was changed to histidine (CAC) (p.Y206H). This mutation is located in a highly conserved extra-cellular domain and the equivalent mutation in humans is associated with the familial natural short sleep (FNSS) phenotype. (J:325012)

Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Npsr1 Mutation:  38 strains or lines available
References
Original:  J:325012 Xing L, et al., Mutant neuropeptide S receptor reduces sleep duration with preserved memory consolidation. Sci Transl Med. 2019 Oct 16;11(514):eaax2014
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/08/2026
MGI 6.24
The Jackson Laboratory