Gsdmd^em2Jhan
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gsdmd^em2Jhan
• Name: gasdermin D; endonuclease-mediated mutation 2, Jiahuai Han
• MGI ID: MGI:7284155
• Synonyms: Gsdmd^-
• Gene: Gsdmd Location: Chr15:75734176-75739257 bp, + strand Genetic Position: Chr15, 35.0 cM, cytoband D3-E1
• Alliance: Gsdmd^em2Jhan page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: A deletion (CCACCAAAGCCGGAAGAAGATGG in exon 5) knockout allele was created using two sgRNAs (targeting AAGCCGGAAGAAGATGGTGA and CGAGTGGCCCAACTGCTTAT) with CRISPR/Cas9 technology. (J:229325)

Expression

In Mice Carrying this Mutation:

1 RNA-Seq or microarray experiment(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Gsdmd Mutation: 35 strains or lines available

References

• Original: J:229325 He WT, et al., Gasdermin D is an executor of pyroptosis and required for interleukin-1beta secretion. Cell Res. 2015 Dec;25(12):1285-98
• All: 5 reference(s)