2510002D24Rik^em1Lerls
Endonuclease-mediated Allele Detail

Summary

• Symbol: 2510002D24Rik^em1Lerls
• Name: RIKEN cDNA 2510002D24 gene; endonuclease-mediated mutation 1, Laurie Earls
• MGI ID: MGI:7282076
• Synonyms: Pants^SOG-Y
• Gene: 2510002D24Rik Location: Chr16:18655328-18658910 bp, + strand Genetic Position: Chr16, 11.67 cM
• Alliance: 2510002D24Rik^em1Lerls page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Epitope tag)
• Mutation: Insertion
• Mutation details: A guide RNA (gggaggttccagtccgtaggggg) is designed to insert a miniSOG tag and an HA tag into the C-terminus, just before the stop codon. (J:331499)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any 2510002D24Rik Mutation: 10 strains or lines available

References

• Original: J:331499 Kragness S, et al., An Rtn4/Nogo-A-interacting micropeptide modulates synaptic plasticity with age. PLoS One. 2022;17(6):e0269404
• All: 1 reference(s)