Slc2a1em1Mase
Endonuclease-mediated Allele Detail
|
Symbol: |
Slc2a1em1Mase |
Name: |
solute carrier family 2 (facilitated glucose transporter), member 1; endonuclease-mediated mutation 1, Matthias Selbach |
MGI ID: |
MGI:7282075 |
Synonyms: |
GLUT1_P485L |
Gene: |
Slc2a1 Location: Chr4:118966001-118994527 bp, + strand
|
Alliance: |
Slc2a1em1Mase page
|
|
|
Allele Type: |
|
Endonuclease-mediated (Humanized sequence) |
Mutation: |
|
Nucleotide substitutions
|
|
|
Mutation details: Using an sgRNA (targeting GAGGAGCTCTTCCACCCTCT) and an ssODN template (TAGCTGCCTGTGCTCCAGAGAGATCCTTGGGCTGCAGGGAGCAGGCCGGGCTGGGTGTGGGGCTCCTCACACTTGGGAGTCCGCCCCCAacaaGTGGAAGAGCTCCTCGGGTGTCTTGTCACTTTGG) with CRISPR/Cas9 technology, proline codon 485 (CCT) in exon 10 was changed to leucine (TTG) (p.P485L). This mutation creates a dileucine motif with the downstream (C-terminal) flanking leucine in the encoded peptide, which causes mislocalization away from the plasma membrane. The mutation is associated with the human childhood onset GLUT1 deficiency syndrome 2 (GLUT1 deficiency syndrome (G1DS)).
(J:308608)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
Carrying any Slc2a1 Mutation: |
61 strains or lines available
|
|
Original: |
J:308608 Meyer K, et al., Mutations in Disordered Regions Can Cause Disease by Creating Dileucine Motifs. Cell. 2018 Sep 20;175(1):239-253.e17 |
All: |
1 reference(s) |
|