Brme1em2Amp
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Brme1em2Amp |
| Name: |
break repair meiotic recombinase recruitment factor 1; endonuclease-mediated mutation 2, Alberto M Pendas |
| MGI ID: |
MGI:7281854 |
| Synonyms: |
Brme1delta142-472 |
| Gene: |
Brme1 Location: Chr8:84874654-84899219 bp, + strand Genetic Position: Chr8, 40.35 cM, cytoband C3
|
| Alliance: |
Brme1em2Amp page
|
|
| Strain of Origin: |
(C57BL/6J x CBA/J)F2
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: CRISPR/Cas9 technology, using sgRNAs (targeting AACCTCAGGGACTCTCTCTG and GAAGTCTAGTTCCATTGCTG), generated a 993 bp deletion in exon 6 (GRCm39:chr8:84893258-84894251), leading to the deletion of 331 codons and an arginine to threonine codon change at codon 142 at the deletion junction (p.Arg142_Ala473delinsThr). Western blot analysis confirmed absence of protein.
(J:303558)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Brme1 Mutation: |
25 strains or lines available
|
|
| Original: |
J:303558 Felipe-Medina N, et al., A missense in HSF2BP causing primary ovarian insufficiency affects meiotic recombination by its novel interactor C19ORF57/BRME1. Elife. 2020 Aug 26;9:e56996 |
| All: |
1 reference(s) |
|