About   Help   FAQ
Spo11em1Amp
Endonuclease-mediated Allele Detail
Summary
Symbol: Spo11em1Amp
Name: SPO11 initiator of meiotic double stranded breaks; endonuclease-mediated mutation 1, Alberto M Pendas
MGI ID: MGI:7281852
Synonyms: Spo11-
Gene: Spo11  Location: Chr2:172819493-172835369 bp, + strand  Genetic Position: Chr2, 95.64 cM, cytoband H4
Alliance: Spo11em1Amp page
Mutation
origin
Strain of Origin:  (C57BL/6J x CBA/J)F2
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Nucleotide substitutions
 
Mutation detailsCRISPR/Cas9 technology, using sgRNAs (targeting TATGTCTCTATGCAGATGCA and ACACTGACAGCCAGCTCTTT) and an ssODN template, generated a TACTAC to TTCTTC change in exon 5, resulting in tyrosine to phenylalanine substitutions at amino acids 137 and 138 (p.Y112_Y113delinsFF), and inserted (duplicated) a T further downstream, leading to a frameshift and premature stop codon (p.Gly145Leufs*18). (J:303558)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Spo11 Mutation:  23 strains or lines available
References
Original:  J:303558 Felipe-Medina N, et al., A missense in HSF2BP causing primary ovarian insufficiency affects meiotic recombination by its novel interactor C19ORF57/BRME1. Elife. 2020 Aug 26;9:e56996
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory