About   Help   FAQ
Adarem1Stsn
Endonuclease-mediated Allele Detail
Summary
Symbol: Adarem1Stsn
Name: adenosine deaminase, RNA-specific; endonuclease-mediated mutation 1, Daniel B Stetson
MGI ID: MGI:7281512
Synonyms: AdarP195A
Gene: Adar  Location: Chr3:89622329-89660753 bp, + strand  Genetic Position: Chr3, 39.19 cM, cytoband F2
Alliance: Adarem1Stsn page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Nucleotide substitutions
 
Mutation details

Using an sgRNA (targeting GAAGGGGGAAACCTCCTTTGTGG) and an ssODN template (ATCAATCGTATTTTGTACTCCCTGGAAAAGAAGGGAAAGCTGCACAGAGGAAGGGGGAAACCTGCCTTGTGGAGCCTTGTGCCCTTGAGTCAGGCTTGGACTCAGCCCCCTGGAGTTGTGAATCCAGAT) with CRISPR/Cas9 technology, proline codon 195 (CCT) was changed to alanine (GCC) (p.P195A). The mutation affects the Z-alpha Z-DNA-binding domain in the encoded peptide and is equivalent to the p.P193A mutation found in Aicardi-Goutieres syndrome (AGS) patients. (J:308678)

Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Disease models
Loading...
Expression
In Mice Carrying this Mutation: 2 RNA-Seq or microarray experiment(s)
In Structures Affected by this Mutation: 5 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Adar Mutation:  83 strains or lines available
References
Original:  J:308678 Maurano M, et al., Protein kinase R and the integrated stress response drive immunopathology caused by mutations in the RNA deaminase ADAR1. Immunity. 2021 Jul 29;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/14/2026
MGI 6.24
The Jackson Laboratory