Zfp691^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zfp691^em1(IMPC)J
• Name: zinc finger protein 691; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7280909
• Gene: Zfp691 Location: Chr4:119026710-119031392 bp, - strand Genetic Position: Chr4, 55.34 cM
• Alliance: Zfp691^em1(IMPC)J page
• IMPC: Zfp691 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CACCTGAATGAACATCCACA and AACTGTGTATACCGTCCCCC, which resulted in a 1801 bp deletion beginning at Chromosome 4 position 119,169,330 bp and ending after 119,171,130 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000669588 (exon 2) and 271 bp of flanking intronic sequence including the splice acceptor, the ATG start site and 3 UTR, and is predicted to result in a null allele. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Zfp691 Mutation: 13 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)