Fmo3^em1Bdgr
Endonuclease-mediated Allele Detail

Summary

• Symbol: Fmo3^em1Bdgr
• Name: flavin containing monooxygenase 3; endonuclease-mediated mutation 1, Sudha Biddinger
• MGI ID: MGI:7280707
• Gene: Fmo3 Location: Chr1:162781369-162812097 bp, - strand Genetic Position: Chr1, 70.34 cM
• Alliance: Fmo3^em1Bdgr page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: A sgRNA (TGGGAAAGTCATCGGGATAGGGG) is designed to delete a 7-nucleotide region of the gene resulting in a frameshift mutation leading to a premature stop codon. (J:283399)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Fmo3 Mutation: 41 strains or lines available

References

• Original: J:283399 Chen S, et al., Trimethylamine N-Oxide Binds and Activates PERK to Promote Metabolic Dysfunction. Cell Metab. 2019 Dec 3;30(6):1141-1151.e5
• All: 1 reference(s)