Glyr1^em1Dsr
Endonuclease-mediated Allele Detail

Summary

• Symbol: Glyr1^em1Dsr
• Name: glyoxylate reductase 1 homolog (Arabidopsis); endonuclease-mediated mutation 1, Deepak Srivastava
• MGI ID: MGI:7279292
• Synonyms: Glyr1^P495L
• Gene: Glyr1 Location: Chr16:4831773-4867727 bp, - strand Genetic Position: Chr16, 2.49 cM
• Alliance: Glyr1^em1Dsr page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Nucleotide substitutions
• Mutation details: Using an sgRNA (targeting ATGTATTTCAGGTAGAAGTC) and an ssODN template (AGGTGAGCCTGATACTCGGCGGGCAATTTTCATGTAGATCTTTTAAACTTCTAATGAATGGCTTTCCCTTCTCAGATATCCTACAAGGAAACTTTAAACTGGACTTCTACCTGAAATACATTCAGAAGGATCTCCGCCTCGCCATTGCATTGGGTGATGCAGTCAACCACCCCACTCCCATGGCAGCTGCAGCCAATGAG) with CRISPR/Cas9 technology, proline codon 495 (CCT) was changed to leucine (CTG) (p.P495L). This mutation of the highly conserved proline residue in the beta-hydroxyacid dehydrogenase (betaHAD) domain mimics one found in some congenital heart disease (CHD) patients. (J:322763)

Disease models

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Glyr1 Mutation: 30 strains or lines available

References

• Original: J:322763 Gonzalez-Teran B, et al., Transcription factor protein interactomes reveal genetic determinants in heart disease. Cell. 2022 Mar 3;185(5):794-814.e30
• All: 1 reference(s)