About   Help   FAQ
Gt(ROSA)26Sorem1(CAG-Cd55*)Hgr
Endonuclease-mediated Allele Detail
Summary
Symbol: Gt(ROSA)26Sorem1(CAG-Cd55*)Hgr
Name: gene trap ROSA 26, Philippe Soriano; endonuclease-mediated mutation 1, Peter Heeger
MGI ID: MGI:7277810
Synonyms: DAF-TM
Gene: Gt(ROSA)26Sor  Location: Chr6:113044389-113054205 bp, - strand  Genetic Position: Chr6, 52.73 cM
Alliance: Gt(ROSA)26Sorem1(CAG-Cd55*)Hgr page
Mutation
origin
Strain of Origin:  (DBA/2 x C57BL/6)F1
Mutation
description
Allele Type:    Endonuclease-mediated (Conditional ready, Inserted expressed sequence)
Mutation:    Insertion
 
Gt(ROSA)26Sorem1(CAG-Cd55*)Hgr expresses 1 gene
 
Mutation detailsPlasmids encoding gRNAs (AGCACTAGACGTTGAGGTCA and GGCAGGCTTAAAGGCTAACC) are designed to insert a CMV-IE enhancer/chicken beta-actin/rabbit beta-globin hybrid promoter (CAG), followed by a floxed STOP cassette, and the DAF-TM sequence into the endogenous Gt(ROSA)26Sor locus. Specifically, the DAF-TM uses the Cd55 sequence containing the complement regulatory domain, in addition, the signal sequence for glycophosphatidylinositol-(GPI)-anchor addition is replaced with the nonsignaling transmembrane helix domain of human tissue factor. (J:314460)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Gt(ROSA)26Sor Mutation:  1095 strains or lines available
References
Original:  J:314460 Cumpelik A, et al., Dynamic regulation of B cell complement signaling is integral to germinal center responses. Nat Immunol. 2021 Jun;22(6):757-768
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory