Gt(ROSA)26Sor^{em1(CAG-Cd55*)Hgr}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gt(ROSA)26Sor^{em1(CAG-Cd55*)Hgr}
• Name: gene trap ROSA 26, Philippe Soriano; endonuclease-mediated mutation 1, Peter Heeger
• MGI ID: MGI:7277810
• Synonyms: DAF-TM
• Gene: Gt(ROSA)26Sor Location: Chr6:113044389-113054205 bp, - strand Genetic Position: Chr6, 52.73 cM
• Alliance: Gt(ROSA)26Sor^{em1(CAG-Cd55*)Hgr} page

Mutation origin

• Strain of Origin: (DBA/2 x C57BL/6)F1

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready, Inserted expressed sequence)
• Mutation: Insertion
• Gt(ROSA)26Sor^{em1(CAG-Cd55*)Hgr} expresses 1 gene
  Knock-in expresses:
  

  Organism	Expressed Gene	Note
  mouse	Cd55 (MGI:104850)

• Mutation details: Plasmids encoding gRNAs (AGCACTAGACGTTGAGGTCA and GGCAGGCTTAAAGGCTAACC) are designed to insert a CMV-IE enhancer/chicken beta-actin/rabbit beta-globin hybrid promoter (CAG), followed by a floxed STOP cassette, and the DAF-TM sequence into the endogenous Gt(ROSA)26Sor locus. Specifically, the DAF-TM uses the Cd55 sequence containing the complement regulatory domain, in addition, the signal sequence for glycophosphatidylinositol-(GPI)-anchor addition is replaced with the nonsignaling transmembrane helix domain of human tissue factor. (J:314460)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Gt(ROSA)26Sor Mutation: 945 strains or lines available

References

• Original: J:314460 Cumpelik A, et al., Dynamic regulation of B cell complement signaling is integral to germinal center responses. Nat Immunol. 2021 Jun;22(6):757-768
• All: 1 reference(s)