Gt(ROSA)26Sorem1(CAG-Cd55*)Hgr
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Gt(ROSA)26Sorem1(CAG-Cd55*)Hgr |
| Name: |
gene trap ROSA 26, Philippe Soriano; endonuclease-mediated mutation 1, Peter Heeger |
| MGI ID: |
MGI:7277810 |
| Synonyms: |
DAF-TM |
| Gene: |
Gt(ROSA)26Sor Location: Chr6:113044389-113054205 bp, - strand Genetic Position: Chr6, 52.73 cM
|
| Alliance: |
Gt(ROSA)26Sorem1(CAG-Cd55*)Hgr page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Conditional ready, Inserted expressed sequence) |
| Mutation: |
|
Insertion
|
| |
|
Gt(ROSA)26Sorem1(CAG-Cd55*)Hgr expresses
1 gene
Knock-in expresses:
| Organism |
Expressed Gene |
Note |
| mouse |
Cd55 (MGI:104850) |
|
|
| |
|
Mutation details: Plasmids encoding gRNAs (AGCACTAGACGTTGAGGTCA and GGCAGGCTTAAAGGCTAACC) are designed to insert a CMV-IE enhancer/chicken beta-actin/rabbit beta-globin hybrid promoter (CAG), followed by a floxed STOP cassette, and the DAF-TM sequence into the endogenous Gt(ROSA)26Sor locus. Specifically, the DAF-TM uses the Cd55 sequence containing the complement regulatory domain, in addition, the signal sequence for glycophosphatidylinositol-(GPI)-anchor addition is replaced with the nonsignaling transmembrane helix domain of human tissue factor.
(J:314460)
|
|
|
|
|
| Original: |
J:314460 Cumpelik A, et al., Dynamic regulation of B cell complement signaling is integral to germinal center responses. Nat Immunol. 2021 Jun;22(6):757-768 |
| All: |
2 reference(s) |
|