About   Help   FAQ
Mlh1em4Jcs
Endonuclease-mediated Allele Detail
Summary
Symbol: Mlh1em4Jcs
Name: mutL homolog 1; endonuclease-mediated mutation 4, John C Schimenti
MGI ID: MGI:7276205
Synonyms: Mlh1K618T
Gene: Mlh1  Location: Chr9:111057296-111100854 bp, - strand  Genetic Position: Chr9, 60.92 cM
Alliance: Mlh1em4Jcs page
Mutation
origin
Strain of Origin:  FVB/NJ x B6(Cg)-Tyrc-2J/J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Single point mutation
 
Mutation detailsUsing an sgRNA (targeting AGGACGACGGCCCGAAGGAA) and an ssODN template (AAGTGGCTGGACAGAGGACGACGGCCCGAAAGAGGGCCTTGCAGAGTACATTGTTGAGTTTCTGAAGAAGACAGCGGAGATGCTTGCAGACTATTTCTCTGTGGAGATCGATGAGGCGAG) with CRISPR/Cas9 technology, lysine codon 622 (AAA) was changed to threonine (ACA) (c.1865A>C, p.K622T). This is the equivalent of the human p.K618T mutation. (J:324056)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Mlh1 Mutation:  41 strains or lines available
References
Original:  J:324056 Singh P, et al., Human MLH1/3 variants causing aneuploidy, pregnancy loss, and premature reproductive aging. Nat Commun. 2021 Aug 18;12(1):5005
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory