Mlh3em3Jcs
Endonuclease-mediated Allele Detail
|
Symbol: |
Mlh3em3Jcs |
Name: |
mutL homolog 3; endonuclease-mediated mutation 3, John C Schimenti |
MGI ID: |
MGI:7276202 |
Synonyms: |
Mlh3A1394T |
Gene: |
Mlh3 Location: Chr12:85281294-85317373 bp, - strand Genetic Position: Chr12, 39.61 cM
|
Alliance: |
Mlh3em3Jcs page
|
|
|
Allele Type: |
|
Endonuclease-mediated (Humanized sequence) |
Mutation: |
|
Single point mutation
|
|
|
Mutation details: Using an sgRNA (targeting GTCAGCTAAGGGCAGCATTG) and an ssODN template (GAAGAGAGCTGCCGCCTCATCGAAGCTCTGTCCTTGTCCCAGCTGCCATTTCAGTGTACTCATGGGAGACCATCTATGCTGCCCTTAGCTGACCTGGACCACTTGGAGCAGGAAAAACAG) with CRISPR/Cas9 technology, alanine codon 1356 (GCT) was changed to threonine (ACT) (c.4066G>A, p.A1356T). This is the equivalent of the human p.A1394T mutation.
(J:324056)
|
|
|
Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
Carrying any Mlh3 Mutation: |
76 strains or lines available
|
|
Original: |
J:324056 Singh P, et al., Human MLH1/3 variants causing aneuploidy, pregnancy loss, and premature reproductive aging. Nat Commun. 2021 Aug 18;12(1):5005 |
All: |
1 reference(s) |
|