About   Help   FAQ
Ddcem2Gregg
Endonuclease-mediated Allele Detail
Summary
Symbol: Ddcem2Gregg
Name: dopa decarboxylase; endonuclease-mediated mutation 2, Christopher Gregg
MGI ID: MGI:7266270
Synonyms: DdcV5
Gene: Ddc  Location: Chr11:11764101-11848144 bp, - strand  Genetic Position: Chr11, 7.09 cM, cytoband A1-A4
Alliance: Ddcem2Gregg page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Epitope tag, Reporter)
Mutation:    Insertion
 
Mutation detailsA crRNA (AAUGAAAGCAGAGCUGCUUC) was designed to insert the Ddc40HA-V5-P2A-mRuby2-3xNLS construct immediately before the stop codon of the gene. Specifically, the construct contained (from 5'; to 3') the last 40 bp of Ddc coding sequence c-terminally conjugated with a V5 epitope tag, P2A self-cleaving peptide sequence, mRuby2 conjugated with three c-terminal copies of a nuclear localization sequence (3xNLS), stop codon, 37 bp of mutated Ddc 3'-UTR (mUTR) to prevent homology repair between the stop codon and a CRISPR cut site 34 bp downstream (preserving the 3';-splice junction of exon 14), followed by 40 bp of un-mutated Ddc intron 14 sequence. (J:324028)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Ddc Mutation:  128 strains or lines available
References
Original:  J:324028 Bonthuis PJ, et al., Noncanonical genomic imprinting in the monoamine system determines naturalistic foraging and brain-adrenal axis functions. Cell Rep. 2022 Mar 8;38(10):110500
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory