About   Help   FAQ
Ddcem1Gregg
Endonuclease-mediated Allele Detail
Summary
Symbol: Ddcem1Gregg
Name: dopa decarboxylase; endonuclease-mediated mutation 1, Christopher Gregg
MGI ID: MGI:7266267
Synonyms: DdceGFP
Gene: Ddc  Location: Chr11:11764101-11848144 bp, - strand  Genetic Position: Chr11, 7.09 cM, cytoband A1-A4
Alliance: Ddcem1Gregg page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Epitope tag, Reporter)
Mutation:    Insertion
 
Mutation detailsA crRNA (AAUGAAAGCAGAGCUGCUUC) was designed to insert the Ddc-6His-P2A-eGFP-3xNLS construct immediately before the stop codon. Specifically, the construct contained (from 5' to 3') the last 40 bp of Ddc coding sequence c-terminally conjugated with a 6 His epitope tag, P2A self-cleaving peptide sequence, EGFP conjugated with three c-terminal copies of a nuclear localization sequence (3xNLS), stop codon, 37 bp of mutated Ddc 3'-UTR (mUTR) to prevent homology repair between the stop codon and a CRISPR cut site 34 bp downstream (preserving the 3';-splice junction of exon 14), followed by 40 bp of un-mutated Ddc intron 14 sequence. (J:324028)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Ddc Mutation:  128 strains or lines available
References
Original:  J:324028 Bonthuis PJ, et al., Noncanonical genomic imprinting in the monoamine system determines naturalistic foraging and brain-adrenal axis functions. Cell Rep. 2022 Mar 8;38(10):110500
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory