Fpr1^em1Gpt
Endonuclease-mediated Allele Detail

Summary

• Symbol: Fpr1^em1Gpt
• Name: formyl peptide receptor 1; endonuclease-mediated mutation 1, GemPharmatech
• MGI ID: MGI:7261312
• Gene: Fpr1 Location: Chr17:18096733-18104201 bp, - strand Genetic Position: Chr17, 10.63 cM
• Alliance: Fpr1^em1Gpt page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/cas9 mediated recombination using single guide RNAs (ATGAATGAATGTCCGGCAG; AAGTCCTTCACACTCAAGCT; CTTCAGGCTACATGCTCATT; GGGAATGCCTATAGCACAG) created a 2289 bp deletion removing the coding exon of the gene. (J:323061)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Fpr1 Mutation: 29 strains or lines available

References

• Original: J:323061 Li Z, et al., Formyl peptide receptor 1 signaling potentiates inflammatory brain injury. Sci Transl Med. 2021 Aug 4;13(605)
• All: 1 reference(s)