Brca2^em1Maas
Endonuclease-mediated Allele Detail

Summary

• Symbol: Brca2^em1Maas
• Name: breast cancer 2, early onset; endonuclease-mediated mutation 1, Alex Maas
• MGI ID: MGI:7260345
• Synonyms: Brca2^delta12
• Gene: Brca2 Location: Chr5:150446095-150493794 bp, + strand Genetic Position: Chr5, 89.52 cM
• Alliance: Brca2^em1Maas page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/cas9 mediated recombination using targeting RNAs (TAATATTCCAACCCTCGTGT and GAAATGTACACCTCATT) deleted exon 12. This deletion removes many of the HSF2BP-binding sites. (J:322962)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Brca2 Mutation: 131 strains or lines available

References

• Original: J:322962 Ghouil R, et al., BRCA2 binding through a cryptic repeated motif to HSF2BP oligomers does not impact meiotic recombination. Nat Commun. 2021 Jul 29;12(1):4605
• All: 1 reference(s)