Alx1em1Jian
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Alx1em1Jian |
| Name: |
ALX homeobox 1; endonuclease-mediated mutation 1, Rulang Jiang |
| MGI ID: |
MGI:7258422 |
| Synonyms: |
Alx1del |
| Gene: |
Alx1 Location: Chr10:102834564-102865501 bp, - strand Genetic Position: Chr10, 53.56 cM
|
| Alliance: |
Alx1em1Jian page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Not Applicable) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: CRISPR/Cas9 technology using sgRNAs targeting intron 1 (GTAAGATGTGGGTGGTACT) and intron 2 (TTACTAAGTATAGGGACAGG) deleted exon 2. Sequencing of RT-PCR products confirmed the production of mutant mRNAs from splicing exon 1 to exon 3, which leads to a frame-shift and is predicted to produce a truncated protein containing only the N-terminal region and lacking the homeodomain and the C-terminal Aristaless domain. Western blot analysis confirmed that embryos lack full-length protein and only produce truncated product that is expressed at low levels.
(J:320497)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Alx1 Mutation: |
23 strains or lines available
|
|
| Original: |
J:320497 Iyyanar PPR, et al., Alx1 Deficient Mice Recapitulate Craniofacial Phenotype and Reveal Developmental Basis of ALX1-Related Frontonasal Dysplasia. Front Cell Dev Biol. 2022;10:777887 |
| All: |
2 reference(s) |
|