Cxcl10^em1Jhan
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cxcl10^em1Jhan
• Name: C-X-C motif chemokine ligand 10; endonuclease-mediated mutation 1, Jiahuai Han
• MGI ID: MGI:7258411
• Synonyms: Cxcl10^-
• Gene: Cxcl10 Location: Chr5:92494497-92496748 bp, - strand Genetic Position: Chr5, 46.57 cM
• Alliance: Cxcl10^em1Jhan page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Not Specified
• Mutation details: A 572 bp deletion (GAGAGGGATCCCTGCAGGAAGAGAGGGG..CTTGAGTCCCACTCAGACCCAGC) knockout allele was created using sgRNAs (targeting GAGTCCCACTCAGACCCAGC and AGCGGACCGTCCTTGCGAGA) with CRISPR/Cas9 technology. (J:309361)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Cxcl10 Mutation: 22 strains or lines available

References

• Original: J:309361 Zhang Y, et al., A unique death pathway keeps RIPK1 D325A mutant mice in check at embryonic day 10.5. PLoS Biol. 2021 Aug;19(8):e3001304
• All: 1 reference(s)