Casp4^em1Jhan
Endonuclease-mediated Allele Detail

Summary

• Symbol: Casp4^em1Jhan
• Name: caspase 4, apoptosis-related cysteine peptidase; endonuclease-mediated mutation 4, Jiahuai Han
• MGI ID: MGI:7258406
• Synonyms: Casp11^-
• Gene: Casp4 Location: Chr9:5308828-5336783 bp, + strand Genetic Position: Chr9, 2.46 cM, cytoband A1
• Alliance: Casp4^em1Jhan page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Not Specified
• Mutation details: A 122 bp deletion (CCGTACACGAAAGGCTCTTATCATATG..AAAGGCCTTCTTGAAGACTTAGGCTACGATGTGG) knockout allele was created using sgRNAs (targeting GCCAATGGCCGTACACGAAAGG and GACTTAGGCTACGATGTGG) with CRISPR/Cas9 technology. (J:309361)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Casp4 Mutation: 35 strains or lines available

References

• Original: J:309361 Zhang Y, et al., A unique death pathway keeps RIPK1 D325A mutant mice in check at embryonic day 10.5. PLoS Biol. 2021 Aug;19(8):e3001304
• All: 1 reference(s)