Abca6em1Nju
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Abca6em1Nju |
| Name: |
ATP-binding cassette, sub-family A member 6; endonuclease-mediated mutation 1, Model Animal Research Center of Nanjing University |
| MGI ID: |
MGI:7256952 |
| Synonyms: |
Abca6 C1366R |
| Gene: |
Abca6 Location: Chr11:110067646-110142602 bp, - strand Genetic Position: Chr11, 73.37 cM
|
| Alliance: |
Abca6em1Nju page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Humanized sequence) |
| Mutation: |
|
Nucleotide substitutions
|
| |
|
Mutation details: Using an sgRNA (targeting TGAGTTTGGATACTGCCCTC) and an ssODN template with CRISPR/Cas9 technology, cysteine codon 1366 (TGC) was changed to arginine (AGA) (p.C1366R). This mutation is associated with hypercholestrolemia in humans. Transcript levels from this allele are normal, but peptide expression in liver is barely detectable.
(J:311129)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Abca6 Mutation: |
91 strains or lines available
|
|
| Original: |
J:311129 He B, et al., Hypercholesterolemia risk associated Abca6 does not regulate lipoprotein metabolism in mice or hamster. Biochim Biophys Acta Mol Cell Biol Lipids. 2021 Nov;1866(11):159006 |
| All: |
1 reference(s) |
|