About   Help   FAQ
Tmem43em1Cby
Endonuclease-mediated Allele Detail
Summary
Symbol: Tmem43em1Cby
Name: transmembrane protein 43; endonuclease-mediated mutation 1, Byung Yoon Choi
MGI ID: MGI:6888277
Synonyms: Tmem43KI, Tmem43-p.(Arg372Ter), Tmem43tm1Cby
Gene: Tmem43  Location: Chr6:91450689-91465445 bp, + strand  Genetic Position: Chr6, 40.54 cM, cytoband D2
Alliance: Tmem43em1Cby page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Dominant negative, Humanized sequence)
Mutation:    Single point mutation
 
Mutation detailsUsing gRNAs (targeting TTAGAGCAGCCCACAGCGGTCGG and CCGATTAGAGCAGCCCACAGCGG) and an ssODN template with CRISPR/Cas9 technology, arginine codon 372 (CGA) in exon 12 was changed to a stop codon (TGA)(c.1114C>T, p.R372*). Proline codon 373 (CCG) was also changed to a stop codon (TGA)(c.1117_1119delinsTGA, p.P373*). The arginine residue is highly conserved and part of loop 3 between the 3rd and 4th transmembrane domains TM3 and TM4 and this mutation is associated with auditory neuropathy spectrum disorder (ANSD) in human. (J:314357)
Inheritance:    Dominant
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Tmem43 Mutation:  31 strains or lines available
References
Original:  J:314357 Jang MW, et al., A nonsense TMEM43 variant leads to disruption of connexin-linked function and autosomal dominant auditory neuropathy spectrum disorder. Proc Natl Acad Sci U S A. 2021 Jun 1;118(22):e2019681118
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory