Tmem43em1Cby
Endonuclease-mediated Allele Detail
|
Symbol: |
Tmem43em1Cby |
Name: |
transmembrane protein 43; endonuclease-mediated mutation 1, Byung Yoon Choi |
MGI ID: |
MGI:6888277 |
Synonyms: |
Tmem43KI, Tmem43-p.(Arg372Ter), Tmem43tm1Cby |
Gene: |
Tmem43 Location: Chr6:91450689-91465445 bp, + strand Genetic Position: Chr6, 40.54 cM, cytoband D2
|
Alliance: |
Tmem43em1Cby page
|
|
|
Allele Type: |
|
Endonuclease-mediated (Dominant negative, Humanized sequence) |
Mutation: |
|
Single point mutation
|
|
|
Mutation details: Using gRNAs (targeting TTAGAGCAGCCCACAGCGGTCGG and CCGATTAGAGCAGCCCACAGCGG) and an ssODN template with CRISPR/Cas9 technology, arginine codon 372 (CGA) in exon 12 was changed to a stop codon (TGA)(c.1114C>T, p.R372*). Proline codon 373 (CCG) was also changed to a stop codon (TGA)(c.1117_1119delinsTGA, p.P373*). The arginine residue is highly conserved and part of loop 3 between the 3rd and 4th transmembrane domains TM3 and TM4 and this mutation is associated with auditory neuropathy spectrum disorder (ANSD) in human.
(J:314357)
|
Inheritance: |
|
Dominant |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
Carrying any Tmem43 Mutation: |
31 strains or lines available
|
|
Original: |
J:314357 Jang MW, et al., A nonsense TMEM43 variant leads to disruption of connexin-linked function and autosomal dominant auditory neuropathy spectrum disorder. Proc Natl Acad Sci U S A. 2021 Jun 1;118(22):e2019681118 |
All: |
1 reference(s) |
|