Mageh1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mageh1^em1(IMPC)J
• Name: MAGE family member H1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6887985
• Gene: Mageh1 Location: ChrX:151819162-151820559 bp, - strand Genetic Position: ChrX, 68.46 cM, cytoband F2
• Alliance: Mageh1^em1(IMPC)J page
• IMPC: Mageh1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mageh1^em1(IMPC)J involves 1 genes/genome features (9530051G07Rik) View all
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGTGTTGTAGGGAATGGGCA and GCCAAAAGCTATGAACCAAT, which resulted in a 1786 bp deletion beginning at Chromosome X position 153,036,011 bp and ending after 153,037,796 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000377789 (exon 1) and 376 bp of flanking intergenic sequence including the start site splice acceptor and donor and is predicted to result in a null allele. In addition, this deletion removes the first exon of long noncoding (LNC)RNA 9530051G07Rik as well as 101 bp of intron 1. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Mageh1 Mutation: 6 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)