About   Help   FAQ
Mageh1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Mageh1em1(IMPC)J
Name: MAGE family member H1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6887985
Gene: Mageh1  Location: ChrX:151819162-151820559 bp, - strand  Genetic Position: ChrX, 68.46 cM, cytoband F2
Alliance: Mageh1em1(IMPC)J page
IMPC: Mageh1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
  Mageh1em1(IMPC)J involves 1 genes/genome features (9530051G07Rik) View all
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGTGTTGTAGGGAATGGGCA and GCCAAAAGCTATGAACCAAT, which resulted in a 1786 bp deletion beginning at Chromosome X position 153,036,011 bp and ending after 153,037,796 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000377789 (exon 1) and 376 bp of flanking intergenic sequence including the start site splice acceptor and donor and is predicted to result in a null allele. In addition, this deletion removes the first exon of long noncoding (LNC)RNA 9530051G07Rik as well as 101 bp of intron 1. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Mageh1 Mutation:  4 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory