About   Help   FAQ
Atxn2em4Lutzy
Endonuclease-mediated Allele Detail
Summary
Symbol: Atxn2em4Lutzy
Name: ataxin 2; endonuclease-mediated mutation 4, Cathy Lutz
MGI ID: MGI:6887967
Synonyms: Atxn2delEx2
Gene: Atxn2  Location: Chr5:121849794-121954372 bp, + strand  Genetic Position: Chr5, 61.93 cM, cytoband F
Alliance: Atxn2em4Lutzy page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsCRISPR/cas9 genome editing used guide RNAs [TCCTGTCACACTATATTAGA, GCCATCTAATATAGTGTGAC, GTCAAGGGTTTTGATGTTCC and AACTCTGCAAACTCTGGTCC] to target exon 2. Donor DNAs were designed to delete exon 2 resulting in a change of amino acid sequence after residue 214 and an early truncation 9 amino acids later. (J:94077)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Atxn2 Mutation:  90 strains or lines available
References
Original:  J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory