About   Help   FAQ
P2rx2em1Xzl
Endonuclease-mediated Allele Detail
Summary
Symbol: P2rx2em1Xzl
Name: purinergic receptor P2X, ligand-gated ion channel, 2; endonuclease-mediated mutation 1, Xue Zhong Liu
MGI ID: MGI:6886215
Synonyms: P2rx2 c.179G>C, P2rx2 KI, P2rx2 p.V61L
Gene: P2rx2  Location: Chr5:110487678-110491078 bp, - strand  Genetic Position: Chr5, 53.49 cM
Alliance: P2rx2em1Xzl page
Mutation
origin
Strain of Origin:  CBA/J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Single point mutation
 
Mutation detailsUsing sgRNA (targeting GCACGATGAAGACGTACCTG) and an ssODN template with CRISPR/Cas9 technology, valine codon 61 (GTC) in exon 2 was changed to leucine (CTC) (c.181G>C, p.V61L). This mutation mimics the human p.V60L mutation associated with a form of dominant early-onset progressive sensorineural hearing loss (DFNA41). (J:315007)
Inheritance:    Dominant
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Disease models
Loading...
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any P2rx2 Mutation:  30 strains or lines available
References
Original:  J:315007 Chen X, et al., Generation and characterization of a P2rx2 V60L mouse model for DFNA41. Hum Mol Genet. 2021 May 31;30(11):985-995
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory