About   Help   FAQ
Kcnq2em8Lutzy
Endonuclease-mediated Allele Detail
Summary
Symbol: Kcnq2em8Lutzy
Name: potassium voltage-gated channel, subfamily Q, member 2; endonuclease-mediated mutation 8, Cathy Lutz
MGI ID: MGI:6883657
Synonyms: Kcng2indel
Gene: Kcnq2  Location: Chr2:180717372-180777093 bp, - strand  Genetic Position: Chr2, 103.57 cM, cytoband H3-4
Alliance: Kcnq2em8Lutzy page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Not Specified)
Mutation:    Intragenic deletion
 
Mutation detailsCRISPR/cas9 genome editing uses a guide RNA (GGTAGTCTACGCTCACAGCA) to target exon 4. The resulting indel mutation was identified as a 1 bp insertion (A) in the PAM site at aa 229. The mutation creates a frameshift mutation. (J:94077)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Kcnq2 Mutation:  49 strains or lines available
References
Original:  J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory