About   Help   FAQ
Kcnq2em6Lutzy
Endonuclease-mediated Allele Detail
Summary
Symbol: Kcnq2em6Lutzy
Name: potassium voltage-gated channel, subfamily Q, member 2; endonuclease-mediated mutation 6, Cathy Lutz
MGI ID: MGI:6883621
Synonyms: Kcnq2H228R
Gene: Kcnq2  Location: Chr2:180717372-180777093 bp, - strand  Genetic Position: Chr2, 103.57 cM, cytoband H3-4
Alliance: Kcnq2em6Lutzy page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Not Specified)
Mutation:    Nucleotide substitutions
 
Mutation detailsCRISPR/cas9 genome editing using guide RNA (GGTAGTCTACGCTCACAGCA) to target exon 4. Donor DNAs were created encoding an H228R mutation (CAT to CGT, histidine to arginine) as well as a silent mutation S229S (AGC to TCC). (J:94077)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Kcnq2 Mutation:  49 strains or lines available
References
Original:  J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory