About   Help   FAQ
Adcy5em6Lutzy
Endonuclease-mediated Allele Detail
Summary
Symbol: Adcy5em6Lutzy
Name: adenylate cyclase 5; endonuclease-mediated mutation 6, Cathy Lutz
MGI ID: MGI:6883558
Synonyms: Adcy5M1030K
Gene: Adcy5  Location: Chr16:34975247-35126108 bp, + strand  Genetic Position: Chr16, 24.71 cM, cytoband B-5
Alliance: Adcy5em6Lutzy page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Not Specified)
Mutation:    Nucleotide substitutions
 
Mutation detailsCRISPR/cas9 genome editing use guide RNAs (TCCCCAGGCCACAGAAGAGA and CCAGGCCACAGAAGAGAAGG) to target exon 18. Donor DNAs were created encoding a M1030K mutation (ATG to AAG, methionine to lysine) and a silent mutation (K1027K, AAG to AAA). (J:94077)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Adcy5 Mutation:  68 strains or lines available
References
Original:  J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory