About   Help   FAQ
Tent5dem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Tent5dem1(IMPC)J
Name: terminal nucleotidyltransferase 5D; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6879492
Gene: Tent5d  Location: ChrX:106836196-106916515 bp, + strand  Genetic Position: ChrX, 47.62 cM
Alliance: Tent5dem1(IMPC)J page
IMPC: Tent5d gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTGAATGCAAACATGTTCCC and TGGTATGATTGCTAAAAGTT, which resulted in a 3070 bp deletion beginning at Chromosome X position 107,870,055 bp and ending after 107,873,124 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000653984 (exon 6) and 455 bp of flanking intronic sequence including the splice acceptor and start site and is predicted to result in a null allele. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Tent5d Mutation:  3 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory