About   Help   FAQ
Prkdcem1Lutzy
Endonuclease-mediated Allele Detail
Summary
Symbol: Prkdcem1Lutzy
Name: protein kinase, DNA activated, catalytic polypeptide; endonuclease-mediated mutation 1, Cathy Lutz
MGI ID: MGI:6877105
Synonyms: Prkdc flox exon5
Gene: Prkdc  Location: Chr16:15455730-15660099 bp, + strand  Genetic Position: Chr16, 10.09 cM, cytoband B1
Alliance: Prkdcem1Lutzy page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Conditional ready)
Mutation:    Insertion
 
Mutation detailsCRISPR/cas9 genome editing is used to insert loxP sites flanking exon 5. Guide RNAs were selected to target upstream [ACTTTCCTATAACCCCAAGT ; CTTGGGAGTGACACCTACTT] and downstream [AAGTAGATTTAGATAAAACT ; AGTAGATTTAGATAAAACTT] of exon 5. (J:101977)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Prkdc Mutation:  400 strains or lines available
References
Original:  J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory