About   Help   FAQ
Trex1em3Lutzy
Endonuclease-mediated Allele Detail
Summary
Symbol: Trex1em3Lutzy
Name: three prime repair exonuclease 1; endonuclease-mediated mutation 3, Cathy Lutz
MGI ID: MGI:6870528
Synonyms: Trex1indel
Gene: Trex1  Location: Chr9:108887000-108888791 bp, - strand  Genetic Position: Chr9, 59.63 cM
Alliance: Trex1em3Lutzy page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Not Specified)
Mutation:    Intragenic deletion
 
Mutation detailsCRISPR/cas9 genome editing used CrRNAs to target upstream (CCTTCAGCAGGTACTATCCA; CCCTTCAGCAGGTACTATCC) and downstream (CTGGCCATGCTCAGGCCCTA; ATGCTCAGGCCCTAGGGATG) regions of exon 2 designed to create a floxed conditional line, nstead created a 1156 bp deletion incorporating exon 2 (CCCTCCAGCTTCTAGTGGCCCTGG/del1156/AGGTACAGTCCCTCTCTCCTGCTCTCTTAGCAGGACAA). (J:101977)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Trex1 Mutation:  29 strains or lines available
References
Original:  J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory