About   Help   FAQ
Kif5aem6Lutzy
Endonuclease-mediated Allele Detail
Summary
Symbol: Kif5aem6Lutzy
Name: kinesin family member 5A; endonuclease-mediated mutation 6, Cathy Lutz
MGI ID: MGI:6870522
Synonyms: Kif5aY279Y,R280C
Gene: Kif5a  Location: Chr10:127061565-127099217 bp, - strand  Genetic Position: Chr10, 74.5 cM
Alliance: Kif5aem6Lutzy page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Not Specified)
Mutation:    Nucleotide substitutions
 
Mutation detailsCRISPR/cas9 genome editing uses guide RNAs (GTCATTTTGCTGTCGCGGTA; TCCTCGTCATTTTGCTGTCG) to introduce an R280C (CGC to TGC) knock-in mutation and a silent Y279Y (TAC to TAT) to exon 10. (J:101977)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Kif5a Mutation:  55 strains or lines available
References
Original:  J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory