Kif5a^em6Lutzy
Endonuclease-mediated Allele Detail

Summary

• Symbol: Kif5a^em6Lutzy
• Name: kinesin family member 5A; endonuclease-mediated mutation 6, Cathy Lutz
• MGI ID: MGI:6870522
• Synonyms: Kif5a^Y279Y,R280C
• Gene: Kif5a Location: Chr10:127061565-127099217 bp, - strand Genetic Position: Chr10, 74.5 cM
• Alliance: Kif5a^em6Lutzy page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Nucleotide substitutions
• Mutation details: CRISPR/cas9 genome editing uses guide RNAs (GTCATTTTGCTGTCGCGGTA; TCCTCGTCATTTTGCTGTCG) to introduce an R280C (CGC to TGC) knock-in mutation and a silent Y279Y (TAC to TAT) to exon 10. (J:101977)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Kif5a Mutation: 55 strains or lines available

References

• Original: J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017
• All: 1 reference(s)