Pfn1^em3Lutzy
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pfn1^em3Lutzy
• Name: profilin 1; endonuclease-mediated mutation 3, Cathy Lutz
• MGI ID: MGI:6870519
• Synonyms: Pfn1^del137
• Gene: Pfn1 Location: Chr11:70542676-70545470 bp, - strand Genetic Position: Chr11, 43.21 cM, cytoband A-D
• Alliance: Pfn1^em3Lutzy page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/cas9 genome editing used guide RNAs (TACCACGTGTCCTTCGGCTC; ATACCACGTGTCCTTCGGCT) designed to introduce a knock-in mutation and instead created a 137 bp deletion mutation involving intron 1 and exon 2 (GAGGACAAGTTATGCAGGTGCA/del137/AGACGGGGAATTTACAATGG). (J:101977)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Pfn1 Mutation: 10 strains or lines available

References

• Original: J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017
• All: 1 reference(s)