Gba1^em1Mcook
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gba1^em1Mcook
• Name: glucosylceramidase beta 1; endonuclease-mediated mutation 1, Mark Cookson
• MGI ID: MGI:6867816
• Synonyms: Gba^E326K
• Gene: Gba1 Location: Chr3:89110235-89116273 bp, + strand Genetic Position: Chr3, 39.01 cM
• Alliance: Gba1^em1Mcook page

Mutation origin

• Strain of Origin: MF1 x C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details: CRISPR/Cas9 methodologies is used to incorporate an E344K (also designated E326K) (GAG to AAG) knock-in in exon 8 (NM_001077411.4) and 2 silent mutations: wildtype CCAAAGCTACTTTAGGAGAGACA to mutant CtAAgGCcACTTTAGGAAAGACA. This mutation corresponds to a human coding variant potentially associated with increased susceptibility to familial Parkinsons disease. (J:101977)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Gba1 Mutation: 46 strains or lines available

References

• Original: J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017
• All: 1 reference(s)