About   Help   FAQ
Kif1aem13Lutzy
Endonuclease-mediated Allele Detail
Summary
Symbol: Kif1aem13Lutzy
Name: kinesin family member 1A; endonuclease-mediated mutation 13, Cathy Lutz
MGI ID: MGI:6865786
Synonyms: Kif1aindel
Gene: Kif1a  Location: Chr1:92943186-93029673 bp, - strand  Genetic Position: Chr1, 46.74 cM, cytoband E1-E2
Alliance: Kif1aem13Lutzy page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutation:    Insertion
 
Mutation detailsCRISPR/cas9 genome editing used guide RNAs (TTTCCCGGGAGTTGAAGGGG and TCATTTCCCGGGAGTTGAAG) to target exon 2, which resulted in a 1 bp insertion (T) in exon 2 (indel mutation). (J:94077)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Kif1a Mutation:  97 strains or lines available
References
Original:  J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory