About   Help   FAQ
Pfn1em4Lutzy
Endonuclease-mediated Allele Detail
Summary
Symbol: Pfn1em4Lutzy
Name: profilin 1; endonuclease-mediated mutation 4, Cathy Lutz
MGI ID: MGI:6864514
Synonyms: Pfn1C71F,R75R
Gene: Pfn1  Location: Chr11:70542676-70545470 bp, - strand  Genetic Position: Chr11, 43.21 cM, cytoband A-D
Alliance: Pfn1em4Lutzy page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Not Specified)
Mutations:    Insertion, Nucleotide substitutions
 
Mutation detailsCRISPR/Cas9 genome editing used guide RNAs (TACCACGTGTCCTTCGGCTC; ATACCACGTGTCCTTCGGCT) to introduce a C71G (TGT to GGT) knock-in mutation and an R75R (CGG to CGC) silent mutation to exon 2. (J:101977)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Pfn1 Mutation:  10 strains or lines available
References
Original:  J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/14/2026
MGI 6.24
The Jackson Laboratory