About   Help   FAQ
Gt(ROSA)26Sorem4(CAG-ZsGreen1)Jahe
Endonuclease-mediated Allele Detail
Summary
Symbol: Gt(ROSA)26Sorem4(CAG-ZsGreen1)Jahe
Name: gene trap ROSA 26, Philippe Soriano; endonuclease-mediated mutation 4, Jason Heaney
MGI ID: MGI:6864088
Synonyms: Ai6-HDR2
Gene: Gt(ROSA)26Sor  Location: Chr6:113044389-113054205 bp, - strand  Genetic Position: Chr6, 52.73 cM
Alliance: Gt(ROSA)26Sorem4(CAG-ZsGreen1)Jahe page
Mutation
origin
Strain of Origin:  B6.Cg-Gt(ROSA)26Sortm6(CAG-ZsGreen1)Hze/J
Project Collection: CPMM
Mutation
description
Allele Type:    Endonuclease-mediated (Reporter)
Mutation:    Insertion
 
Mutation detailsCRISPR/Cas9 genome editing removed the transcriptional stop cassette and flanking loxP sites in the existing Rosa-CAG-LSL-ZsGreen1-WPRE conditional allele using guides 5 AAAGAATTGATTTGATACCG (PAM CGG) and 5 GTATGCTATACGAAGTTATT (PAM AGG) to activate ZsGreen1 expression. Subsequently, CRISPR/Cas9 genome editing with a single-stranded DNA in mouse embryos from this seed line was used to introduce sequence harboring a guide target site and PAM compatible with SauCas9 [5 ACGAAGTTATATTAAGGGTT (PAM CCGGAT)]. Introduction of this sequence disrupted the ZsGreen1 chromophore and introduced a premature stop codon, which disrupts ZsGreen1 expression and fluorescence. Homology-directed repair with a DNA donor can restore ZsGreen1 sequence, expression, and fluorescence. (J:302569)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Gt(ROSA)26Sor Mutation:  1096 strains or lines available
References
Original:  J:302569 Heaney J, Direct data submission for Gt(ROSA)26Sor allele from Dr. Heaney. MGI Direct Data Submission. 2021;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory