Gt(ROSA)26Sor^{em4(CAG-ZsGreen1)Jahe}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gt(ROSA)26Sor^{em4(CAG-ZsGreen1)Jahe}
• Name: gene trap ROSA 26, Philippe Soriano; endonuclease-mediated mutation 4, Jason Heaney
• MGI ID: MGI:6864088
• Synonyms: Ai6-HDR2
• Gene: Gt(ROSA)26Sor Location: Chr6:113044389-113054205 bp, - strand Genetic Position: Chr6, 52.73 cM
• Alliance: Gt(ROSA)26Sor^{em4(CAG-ZsGreen1)Jahe} page

Mutation origin

• Strain of Origin: B6.Cg-Gt(ROSA)26Sor^{tm6(CAG-ZsGreen1)Hze}/J
• Project Collection: CPMM

Mutation description

• Allele Type: Endonuclease-mediated (Reporter)
• Mutation: Insertion
• Mutation details: CRISPR/Cas9 genome editing removed the transcriptional stop cassette and flanking loxP sites in the existing Rosa-CAG-LSL-ZsGreen1-WPRE conditional allele using guides 5 AAAGAATTGATTTGATACCG (PAM CGG) and 5 GTATGCTATACGAAGTTATT (PAM AGG) to activate ZsGreen1 expression. Subsequently, CRISPR/Cas9 genome editing with a single-stranded DNA in mouse embryos from this seed line was used to introduce sequence harboring a guide target site and PAM compatible with SauCas9 [5 ACGAAGTTATATTAAGGGTT (PAM CCGGAT)]. Introduction of this sequence disrupted the ZsGreen1 chromophore and introduced a premature stop codon, which disrupts ZsGreen1 expression and fluorescence. Homology-directed repair with a DNA donor can restore ZsGreen1 sequence, expression, and fluorescence. (J:302569)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Gt(ROSA)26Sor Mutation: 1095 strains or lines available

References

• Original: J:302569 Heaney J, Direct data submission for Gt(ROSA)26Sor allele from Dr. Heaney. MGI Direct Data Submission. 2021
• All: 1 reference(s)