Gt(ROSA)26Sorem3(CAG-ZsGreen1)Jahe
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Gt(ROSA)26Sorem3(CAG-ZsGreen1)Jahe |
| Name: |
gene trap ROSA 26, Philippe Soriano; endonuclease-mediated mutation 3, Jason Heaney |
| MGI ID: |
MGI:6864087 |
| Synonyms: |
Ai6-HDR1 |
| Gene: |
Gt(ROSA)26Sor Location: Chr6:113044389-113054205 bp, - strand Genetic Position: Chr6, 52.73 cM
|
| Alliance: |
Gt(ROSA)26Sorem3(CAG-ZsGreen1)Jahe page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Reporter) |
| Mutation: |
|
Insertion
|
| |
|
Mutation details: CRISPR/Cas9 genome editing removed the transcriptional stop cassette and flanking loxP sites in the existing Rosa-CAG-LSL-ZsGreen1-WPRE conditional allele using guides 5 AAAGAATTGATTTGATACCG (PAM CGG) and 5 GTATGCTATACGAAGTTATT (PAM AGG) to activate ZsGreen1 expression. Subsequently, CRISPR/Cas9 genome editing with a single-stranded DNA in mouse embryos from this seed line was used to introduce sequence harboring a guide target site and PAMs compatible with A.s. and L.b Cas12a, SauCas9, and SpyCas9 [5 TTTGTATGCTATACGAAGTTATTAGGAGT]. Introduction of this sequence disrupted the ZsGreen1 chromophore and introduced a premature stop codon, which disrupts ZsGreen1 expression and fluorescence. Homology-directed repair with a DNA donor can restore ZsGreen1 sequence, expression, and fluorescence.
(J:302569)
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Gt(ROSA)26Sor Mutation: |
1096 strains or lines available
|
|
| Original: |
J:302569 Heaney J, Direct data submission for Gt(ROSA)26Sor allele from Dr. Heaney. MGI Direct Data Submission. 2021; |
| All: |
2 reference(s) |
|