About   Help   FAQ
Zc4h2em3Lutzy
Endonuclease-mediated Allele Detail
Summary
Symbol: Zc4h2em3Lutzy
Name: zinc finger, C4H2 domain containing; endonuclease-mediated mutation 3, Cathy Lutz
MGI ID: MGI:6861845
Synonyms: Zc4h2del394
Gene: Zc4h2  Location: ChrX:94682799-94702115 bp, - strand  Genetic Position: ChrX, 41.99 cM
Alliance: Zc4h2em3Lutzy page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Insertion
 
Mutation detailsUsing CRISPR/cas9 genome editing, guide RNAs [AATAACATAGTGTAGCAGAA, CCACTGACAGATCTAAGAAT, TTGAGAACTTGAACATAGAC and GATAATAGGACAGACTCCAG] were selected to target exon 3 and delete 394 bp to generate a predicted null mutation. (J:101977)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Zc4h2 Mutation:  3 strains or lines available
References
Original:  J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory