Rag1^em2Lutzy
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rag1^em2Lutzy
• Name: recombination activating 1; endonuclease-mediated mutation 2, Cathleen Lutz
• MGI ID: MGI:6861839
• Gene: Rag1 Location: Chr2:101468627-101479846 bp, - strand Genetic Position: Chr2, 53.88 cM
• Alliance: Rag1^em2Lutzy page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready)
• Mutation: Insertion
• Mutation details: CRISPR/cas9 genome editing is used to insert loxP sites flanking exon 2. The following guide RNAs were selected to target upstream [AAGTGTCCCCAAATATTGTC] and downstream [GCACCTAGCACATTGCCATG] of exon 2. Rag1 transcript Rag1-201 was used as reference for the exon numbering and the guide/donor sequences. (J:101977)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Rag1 Mutation: 120 strains or lines available

References

• Original: J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017
• All: 1 reference(s)