Chrnd^em1(IMPC)Mbp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Chrnd^em1(IMPC)Mbp
• Name: cholinergic receptor, nicotinic, delta polypeptide; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
• MGI ID: MGI:6856844
• Gene: Chrnd Location: Chr1:87118329-87127792 bp, + strand Genetic Position: Chr1, 44.07 cM
• Alliance: Chrnd^em1(IMPC)Mbp page
• IMPC: Chrnd gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at University of California, Davis using Cas9 and guides with spacer sequences CTAGACGTAGCTGATGGAGA and GGACATACATTATACCACTA that targeted exon(s) ENSMUSE00000157311.4 ENSMUSE00000157312.4 ENSMUSE00000157318.4 ENSMUSE00001328538.2. This resulted in deletion(s) of 3 bp (location: Chr1:87119754-87119756; GRCm39), 1189 bp (location: Chr1:87119766-87120954; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Chrnd Mutation: 33 strains or lines available

References

• Original: J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015
• All: 4 reference(s)