Trim7em1(IMPC)Bay
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Trim7em1(IMPC)Bay |
| Name: |
tripartite motif-containing 7; endonuclease-mediated mutation 1, Baylor College of Medicine |
| MGI ID: |
MGI:6856766 |
| Gene: |
Trim7 Location: Chr11:48716965-48742019 bp, + strand Genetic Position: Chr11, 28.8 cM
|
| Alliance: |
Trim7em1(IMPC)Bay page
|
| IMPC: |
Trim7 gene page |
|
| Strain of Origin: |
C57BL/6N
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details:
This allele was generated at Baylor College of Medicine using Cas9 and guides with spacer sequences AGTGATCTCACCCTCCAGCT and GTGGCGCTGGACCTTGAGGT that targeted exon(s) ENSMUSE00000246644.2 ENSMUSE00000246662.3 ENSMUSE00000246698.2 ENSMUSE00000482234.2 ENSMUSE00000679460.2 ENSMUSE00000750573.2 ENSMUSE00000828589.2 ENSMUSE00001798662.1 ENSMUSE00001798663.1 ENSMUSE00001798664.1 ENSMUSE00001798665.1 ENSMUSE00001798674.1 ENSMUSE00001798675.1 ENSMUSE00002189220.1 ENSMUSE00002189222.1. This resulted in deletion(s) of 4273 bp (location: Chr11:48736411-48740683; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Trim7 Mutation: |
42 strains or lines available
|
|
| Original: |
J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015; |
| All: |
4 reference(s) |
|