Pimreg^em1(IMPC)Bay
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pimreg^em1(IMPC)Bay
• Name: PICALM interacting mitotic regulator; endonuclease-mediated mutation 1, Baylor College of Medicine
• MGI ID: MGI:6856735
• Gene: Pimreg Location: Chr11:71932867-71938197 bp, + strand Genetic Position: Chr11, 43.81 cM
• Alliance: Pimreg^em1(IMPC)Bay page
• IMPC: Pimreg gene page

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Baylor College of Medicine using Cas9 and guides with spacer sequences CAGACGATCACTCCTAAAGG and CATGGCACCCAAGGCGCTTT that targeted exon(s) ENSMUSE00001271585.2. This resulted in deletion(s) of 210 bp (location: Chr11:71933929-71934138; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Pimreg Mutation: 12 strains or lines available

References

• Original: J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015
• All: 3 reference(s)