Tnfsf9^em1Ygch
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tnfsf9^em1Ygch
• Name: tumor necrosis factor (ligand) superfamily, member 9; endonuclease-mediated mutation 1, Yi-Guang Chen
• MGI ID: MGI:6852688
• Gene: Tnfsf9 Location: Chr17:57412325-57414757 bp, + strand Genetic Position: Chr17, 29.67 cM
• Alliance: Tnfsf9^em1Ygch page

Mutation origin

• Strain of Origin: NOD/ShiLtJ

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: A single guide RNA (GCGGATGCCAGACATCCAGC) is used to create a 22 nucleotide deletion (AGCAGGTACTTCGTGCCCCTCG) in the first coding exon, immediately downstream of the start codon. The mutant protein is predicted to retain the first 17 amino acids followed by 49 aberrant amino acids prior to a stop codon. (J:288440)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Tnfsf9 Mutation: 20 strains or lines available

References

• Original: J:288440 Foda BM, et al., The CD137 Ligand Is Important for Type 1 Diabetes Development but Dispensable for the Homeostasis of Disease-Suppressive CD137(+) FOXP3(+) Regulatory CD4 T Cells. J Immunol. 2020 Jun 1;204(11):2887-2899
• All: 1 reference(s)